prc2 mi342 plasmids (TaKaRa)
TaKaRa is a verified supplier 
TaKaRa manufactures this product 
94
Structured Review
TaKaRa
prc2 mi342 plasmids
Prc2 Mi342 Plasmids, supplied by TaKaRa, used in various techniques. Bioz Stars score: 94/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/prc2+mi342+plasmids/AAVpro+Helper+Free+System/bio_rxiv__64898__2026__04__30__721990-138-13-15
Average 94 stars, based on 12 article reviews
Prc2 Mi342 Plasmids, supplied by TaKaRa, used in various techniques. Bioz Stars score: 94/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/prc2+mi342+plasmids/AAVpro+Helper+Free+System/bio_rxiv__64898__2026__04__30__721990-138-13-15
Average 94 stars, based on 12 article reviews
prc2 mi342 plasmids - by Bioz Stars,
2026-09
94/100 stars
Images
Related Articles
Recombinant:Article Title: Cell state-dependent chromatin targeting in NUT carcinoma. Article Snippet: The pAAV-nEFCas9 (Addgene, plasmid 87115) was used to express Cas9, and the pAAV-tagBFP U6-gRNA expression vector was used to express a gRNA targeting the start codon of cMYC: (5′ GACGTTGAGGGGCATCGTCGC 3′). .. Recombinant AAV2 was packaged in HEK293T cells using pHelper and Article Title: Cell state-dependent chromatin targeting in NUT carcinoma. Article Snippet: The presence of the correctly tagged MYC protein was validated by western blot probed with a c-MYC antibody (Rabbit mAb, Cell Signaling Technology, Cat# 5605). .. The recombinant pAAV-CRE plasmid was packaged in HEK293T cells using pHelper and Article Title: Cell state-dependent chromatin targeting in NUT carcinoma Article Snippet: The pAAV-nEFCas9 (Addgene, plasmid 87115) was used to express Cas9, and the pAAV-tagBFP U6-gRNA expression vector was used to express a gRNA targeting the start codon of cMYC: (5’ GACGTTGAGGGGCATCGTCGC ’). .. Recombinant AAV2 was packaged in HEK293T cells using pHelper and Article Title: Cell state-dependent chromatin targeting in NUT carcinoma Article Snippet: The presence of the correctly tagged MYC protein was validated by Western blot probed with a c-MYC antibody (Rabbit mAb, Cell Signaling Technology, Cat# 5605). .. The recombinant pAAV-CRE plasmid was packaged in HEK293T cells using pHelper and Article Title: Cell state-dependent chromatin targeting in NUT carcinoma Article Snippet: The pAAV-nEFCas9 (Addgene, plasmid 87115) was used to express Cas9, and the pAAV-tagBFP U6-gRNA expression vector was used to express a gRNA targeting the start codon of cMYC: (5’ GACGTTGAGGGGCATCGTCGC 3’). .. Recombinant AAV2 was packaged in HEK293T cells using pHelper and Article Title: Cell state-dependent chromatin targeting in NUT carcinoma Article Snippet: The presence of the correctly tagged MYC protein was validated by Western blot probed with a c-MYC antibody (Rabbit mAb, Cell Signaling Technology, Cat# 5605). .. The recombinant pAAV-CRE plasmid was packaged in HEK293T cells using pHelper and Article Title: Changes in the Transcriptome and Synthetic Lethal Dependencies Following KRAS Mutant Expression Reveal Profound Tissue-Specificity Article Snippet: .. Recombinant AAV serotype 2 was packaged in 293T cells using the pHelper and Article Title: cMYC protein interactions and chromatin association in NUT carcinoma Article Snippet: The pAAV-nEFCas9 (Addgene, plasmid 87115) was used to express Cas9, and the pAAV-tagBFP U6-gRNA expression vector was used to express a gRNA targeting the start codon of cMYC: gRNA-cMYC-start ( ). .. Recombinant AAV2 was packaged in HEK293T cells using pHelper and Plasmid Preparation:Article Title: Cell state-dependent chromatin targeting in NUT carcinoma. Article Snippet: The presence of the correctly tagged MYC protein was validated by western blot probed with a c-MYC antibody (Rabbit mAb, Cell Signaling Technology, Cat# 5605). .. The recombinant pAAV-CRE plasmid was packaged in HEK293T cells using pHelper and Article Title: Cell state-dependent chromatin targeting in NUT carcinoma Article Snippet: The presence of the correctly tagged MYC protein was validated by Western blot probed with a c-MYC antibody (Rabbit mAb, Cell Signaling Technology, Cat# 5605). .. The recombinant pAAV-CRE plasmid was packaged in HEK293T cells using pHelper and Article Title: Cell state-dependent chromatin targeting in NUT carcinoma Article Snippet: The presence of the correctly tagged MYC protein was validated by Western blot probed with a c-MYC antibody (Rabbit mAb, Cell Signaling Technology, Cat# 5605). .. The recombinant pAAV-CRE plasmid was packaged in HEK293T cells using pHelper and Bioprocessing:Article Title: Changes in the Transcriptome and Synthetic Lethal Dependencies Following KRAS Mutant Expression Reveal Profound Tissue-Specificity Article Snippet: .. Recombinant AAV serotype 2 was packaged in 293T cells using the pHelper and |